The association of TCF7L2 rs7903146 polymorphism with type 2 diabetes mellitus among Tatars of Bashkortostan

Cover Page

Abstract


Aim. To perform the analysis of the association of transcription factor 7-like 2 (TCF7L2) gene rs7903146 polymorphism with type 2 diabetes mellitus (T2DM) among Tatars of Bashkortostan. 

Materials and methods. In this study, 169 patients with T2DM and 286 controls without clinical symptoms and laboratory signs of diabetes and without diabetes relatives were examined. Amplification of the DNA fragments was performed using real-time polymerase chain reaction (PCR) and TaqMan technique. 

Results. Genotype CT and allele T ratios were higher in the T2DM group than in controls (46. 7% vs. 36. 4%, p = 0. 030; 41. 7% vs. 30. 8%, p = 0. 001 respectively). There was a positive association between allele T and T2DM (OR = 1. 61), and allele C had a protective effect (OR = 0. 62, p = 0,001). Carriers of the ТТ genotype had later onset of T2DM (mean = 59. 5 years old) compared with carriers of the CT and CC genotypes (56. 1 years old, p = 0. 044). Basal C-peptide concentration, lipid levels and body mass index were not associated with TCF7L2 rs7903146 polymorphism. 

Conclusion. TCF7L2 rs7903146 polymorphism is associated with T2DM among Tatars of Bashkortostan. 


Сахарный диабет (СД) представляет собой острую медико-социальную и экономическую проблему, обусловленную широкой распространенностью, развитием инвалидизирующих осложнений, а также большими финансовыми затратами на лечение.

В Республике Башкортостан на 1 января 2014 г. количество пациентов, состоящих на диспансерном учете по поводу сахарного диабета 2 типа (СД2), составило 86 474 человека, что почти на 12 000 больше, чем в 2011 г. При этом примерно треть из них (29 734 человека) – инвалиды, а средняя продолжительность жизни от начала заболевания составляет 9,75 лет.

Одной из обсуждаемых сторон проблемы роста социально значимых заболеваний является генетическая основа предрасположенности. Наличие генетической составляющей подтверждается рядом исследований, проведенных на близнецах: установленная конкордантность у однояйцевых близнецов с диабетом составляет 80% и более [1].

СД2 возникает как итог взаимодействия множества генетических факторов с особенностями питания и двигательной активности индивидуума.

Недавними исследованиями был выявлен маркер предрасположенности к СД2 rs7903146 гена TCF7L2 (англ. Transcription factor 7-like 2 – транскрипционный фактор 7, подобный второму), влияющий на пролиферацию, активность и дифференцировку β-клеток.

Белок, кодируемый TCF7L2, является частью Wnt-сигнального пути, необходимого для таких важных биологических процессов, как эмбриогенез, органогенез, туморогенез. Нарушения в передаче Wnt-сигнала играют роль в развитии диабета, что реализуется через пролиферацию бета-клеток, экспрессию глюкагоноподобного пептида 1 (ГПП-1) [2, 3].

Ген TCF7L2 (10q25. 3) был впервые описан в качестве предрасполагающего к СД2 в популяциях исландцев и американцев мексиканского происхождения [4, 5]. Позже данный регион был более подробно картирован у исландцев с использованием 228 микросателлитных маркеров, покрывающих 10,5-Mbp, что позволило ограничить участок в интроне 3 [6]. Ассоциация СД2 с рядом однонуклеотидных полиморфных локусов (ОНП) гена TCF7L2 в последующем была подтверждена многочисленными исследованиями в разных этнических группах. Наиболее сильную ассоциацию с СД2 показали ОНП rs7903146 и rs12255372, расположенные в интронах 3 и 4 [7–9].

Исследования, проведенные в популяции сидхов (Индия), подтвердили ассоциацию с заболеванием 8 локусов, в том числе и TCF7L2-rs7903146, при этом данный маркер оказался наиболее сильным предиктором СД2, как и у европейцев [10]. Среди афроамериканцев полиморфизм rs7903146 TCF7L2 продемонстрировал наибольший показатель соотношения шансов в отношении развития СД2 из 40 локусов [11].

Локус rs7903146 TCF7L2 показал ассоциацию с функцией бета-клеток в ряде исследований [12].

Механизм, посредством которого ген TCF7L2 предрасполагает к СД2, до сих пор до конца непонятен.

Выдвинуто несколько гипотез, объясняющих взаимосвязь данного гена с СД2. Продукт гена TCF7L2 может нарушать способность панкреатических островков продуцировать инсулин в ответ на стимуляцию инсулинотропным интестинальным гормоном ГПП-1 или глюкозой. Эта гипотеза основана на том наблюдении, что TCF7L2 влияет на экспрессию мРНК прекурсора глюкагона in vitro и что делеция этого гена в нокаутированных моделях мышей приводит к потере эпителиальных секретирующих клеток кишечника, которые продуцируют ГПП-1 и другие гормоны [13]. В исследованиях на клеточных линиях с использованием сверхэкспрессии и нокаутирования была показана роль TCF7L2 в образовании инсулиновых гранул и экзоцитозе [14].

L.M. Hart et al. (2010) проанализировали совместное влияние 8 локусов предрасположенности к СД2, ассоциированных с функцией бета-клеток, в том числе TCF7L2, на секрецию инсулина, стимулируемую тремя различными секретагогами в ходе гипергликемических клэмпов. Выявлена достоверная отрицательная корреляция между числом рисковых аллелей и первой фазой секреции инсулина. При этом количество рисковых аллелей не было взаимосвязано со второй фазой секреции инсулина. Это предполагает, что сочетание данных рисковых аллелей преимущественно регулирует экзоцитоз гранул инсулина в ответ на стимуляцию глюкозой [15].

В скандинавском исследовании было показано, что аллель локуса rs7903146*Т ассоциирован с риском развития СД2, нарушенной секрецией инсулина, действием инкретинов и усиленной продукцией глюкозы печенью [16]. Примечательно, что у гомозиготных носителей аллеля rs7903146*Т транскрипционная активность гена TCF7L2 в панкреатических островках была в пять раз выше, чем у обладателей других генотипов. Полагают, что транскрипционный фактор, кодируемый геном TCF7L2, влияет на экспрессию гена проглюкагона и на синтез ГПП-1 в интестинальных эндокринных L-клетках [17]. Исследования, проводимые на людях, продемонстрировали, что у обладателей аллеля риска rs7903146*Т концентрация ГПП-1 находится в пределах референсных значений, но имеет место неадекватный выброс инсулина в ответ на введение ГПП-1 [16–18].

В работах отечественных авторов сообщается о том, что полиморфные маркеры rs12255372 и rs7903146 гена TCF7L2 ассоциированы с развитием СД2 у русских жителей Новосибирской области и г. Москвы [19–20]. Исследования по анализу распределения частот полиморфных вариант гена TCF7L2 у пациентов с СД2 в Республике Башкортостан не проводились.

Цель

Провести анализ ассоциаций полиморфного маркера rs7903146 гена TCF7L2 с СД2 у жителей Республики Башкортостан татарской этнической принадлежности.

Материалы и методы

В исследование было включено 455 человек, мужчин и женщин (табл. 1). Из них 169 пациентов с СД2 и 286 лиц без клинических и лабораторных признаков диабета, а также без наследственной отягощенности по диабету. Обследуемые были татарской этнической принадлежности в трех поколениях и являлись жителями Республики Башкортостан. Описание выборок приведено в таблице 1. 

Таблица 1. Характеристика обследованных выборок

Показатели, m±σ (ДИ)

Контрольная группа

Пациенты с СД2

Возраст, лет

50,2±11,6 (41,0–58,0)

61,4±9,2 (43,0–77,0)

ИМТ, кг/м2

25,7±5,1 (22,1–28,0)

30,1±4,4 (21,0–45,7)

Окружность талии (ОТ), см

92,0±11,0 (74,0–126,0)

102,0±11,2 (74,0–130,0)

Длительность заболевания, лет

6,1±5,3 (0,0–24,0)

Возраст манифестации СД2, лет

55,2±8,9 (43,0–77,0)

Гликогемоглобин, %

4,8±0,6 (4,3–5,3)

6,7±1,3 (5,4–12,0)

Глюкоза плазмы венозной крови натощак, ммоль/л

4,9±0,8 (4,3–5,6)

7,1±1,9 (4,5–12,3)

Примечание: m – среднее арифметическое; σ – стандартное квадратичное отклонение; ДИ – 75% доверительный интервал

 

Нормальную массу тела (ИМТ<25 кг/м2) имели 30 (17,7%) больных, избыточный вес (ИМТ 25–30 кг/м2) – 40 (23,7%), ожирение (ИМТ≥30 кг/м2) – 99 (58,6%) пациентов. На инсулинотерапии находились 20 пациентов, средняя потребность в инсулине составила 51,0±20,0 ЕД (от 35 до 63 ЕД) в сутки.

В контрольной группе нормальную массу тела (ИМТ<25 кг/м2) имели 77 (47,0%) человек, избыточный вес (ИМТ 25–30 кг/м2) – 52 (31,7%), ожирение (ИМТ≥30 кг/м2) – 35 (21,3%) человек. Данные об ИМТ у 122 человек группы сравнения отсутствовали.

Определение содержания общего холестерина (ОХС), триглицеридов (ТГ), холестерина липопротеидов высокой плотности (ЛПВП), холестерина липопротеидов низкой плотности (ЛПНП) проводили методом точечной фотометрии на биохимическом анализаторе «Olimpus» фирмы «Abbott» (Германия) наборами BeckmanCoulter. Определение содержания С-пептида в сыворотке крови проводили методом ферментативно-усиленной хемилюминесценции на автоматическом анализаторе IMMULITE фирмы DPC (США) с использованием реактивов фирмы DPC.

Скорость клубочковой фильтрации (СКФ) рассчитывали по стандартной формуле CKD-EPI (http://mdrd.com/ ).

ДНК выделяли из венозной крови методом фенольно-хлороформной экстракции. Амплификацию участков ДНК проводили с помощью полимеразной цепной реакции (ПЦР) в режиме реального времени с использованием TaqMan-зондов производства фирмы «ТестГен» (табл. 2).

Таблица 2. Последовательности праймеров, флуоресцентных зондов и условия амплификации полиморфного локуса rs7903146 гена TCF7L2

Ген

Полиморфный маркер

Метод генотипирования

Последовательность праймеров, 5`-3`

Последовательность зондов, 5`-3’

Температура отжига, °С

TCF7L2

rs7903146

TaqMan

ggaccaaagagaagattc gcgaagagatgaaatgta

actttttagatactatataatttaa cactttttagatattatataatttaa

58

 

Целевыми показателями липидного обмена считали: ОХС<4,5 ммоль/л, ЛПНП<2,5 ммоль/л, ЛПВП>1,0 ммоль/л (для мужчин) и >1,3 (для женщин), ТГ<1,7 ммоль/л (Алгоритмы специализированной медицинской помощи больным сахарным диабетом, 7-й выпуск).

Статистическая обработка данных проводилась с использованием программ STATISTICA 6. 0 и SNPStats (http://bioinfo.iconcologia.net/snpstats/start.htm?).

Достоверность различий частот генотипов и аллелей определяли с использованием критерия χ2 для таблиц сопряженности 2х2 (http://biometrica.tomsk.ru/freq1. htm ), а также двустороннего теста Фишера. При оценке количественных показателей рассчитывали средние арифметические значения, их стандартные квадратичные отклонения, 75% доверительные интервалы. Показатель соотношения шансов (OR – odds ratio) и 95% доверительный интервал OR (95% CI) рассчитывали по формуле, предложенной J. Bland и соавт. (2000).

Перед включением в исследование все пациенты подписывали информированное добровольное согласие. Исследование одобрено на заседании экспертного совета по биомедицинской этике по клиническим дисциплинам ГБОУ ВПО «Башкирский государственный медицинский университет» Министерства здравоохранения Российской Федерации 15. 11. 2013 г.

Результаты и обсуждение

В таблице 3 представлены результаты генотипирования обследованных лиц по полиморфному участку rs7903146 гена TCF7L2. Обращает на себя внимание более высокая частота генотипа CТ и аллеля Т в группе пациентов с СД2 при сопоставлении со здоровыми индивидуумами (46,7% против 36,4%, P=0,030; 41,7% vs. 30,8%, P=0,001 соответственно). При этом доля обладателей генотипа СС и аллеля С в выборке пациентов, напротив, меньше, чем в группе сравнения: 34,9% и 51,0%, P=0,001; 58,3% и 69,2%, P=0,001 соответственно.

Таблица 3. Распределение генотипов/аллелей полиморфного участка rs7903146TCF7L2 в группе пациентов с СД2 и в контрольной группе

Генотипы/аллели

Распределение генотипов/аллелей в группе пациентов с СД2, n (%)

Распределение генотипов/аллелей в контрольной группе, n (%)

OR (CI 95%)

P (χ2)

СС

59 (34,9)

146 (51,0)

0,51 (0,34–0,76)

0,001 (11,175)

СТ

79 (46,7)

104 (36,4)

1,54 (1,04–2,26)

0,030 (4,762)

ТТ

31 (18,4)

36 (12,6)

1,56 (0,92–2,63)

0,102 (2,803)

С

197 (58,3)

396 (69,2)

0,62 (0,47–0,82)

0,001 (11,215)

Т

141 (41,7)

176 (30,8)

1,61 (1,22–2,13)

Примечание: здесь и далее жирным шрифтом выделены статистически значимые различия.

 

Продемонстрирована ассоциация генотипа CТ с риском развития СД2. Показатель OR составил 1,54 (95% CI=1,04–2,26). Использование аллельного теста показало ассоциацию аллеля Т с риском развития СД2, OR=1,61 (95% CI=1,22–2,13). Генотип CC и аллель С являются протективными в отношении СД2, OR=0,51 и 0,62 соответственно (табл. 3).

Был произведен анализ ассоциаций полиморфного локуса rs7903146 гена TCF7L2 с клинико-метаболическими характеристиками пациентов с СД2, данные которого представлены в таблице 4. 

Таблица 4. Анализ клинических и метаболических параметров в зависимости от полиморфных вариантов гена TCF7L2 rs7903146 (ко-доминантная модель)

Параметры

 

Генотипы

Р

TT

CC

CT

Возраст дебюта СД2*, лет

59,5±1,8

56,1±0,7

0,044

Отягощенная наследственность по СД, %

23,3

40,0

36,7

0,180

Вес, кг

79,6±2,1

77,9±1,8

78,3±1,5

0,830

ИМТ, кг/м2

30,6±0,8

29,9±0,6

30,1 ±0,5

0,770

ОТ, см

100,9±1,9

101,5±1,7

101,9±1,4

0,920

Глюкоза натощак, ммоль/л

6,9±0,4

7,0±0,2

7,3 ±0,3

0,430

HbA1c, %

6,8±0,4

7,0±0,2

7,0±0,3

0,870

С-пептид, нг/мл

1,9±0,2

1,9±0,2

2,5±0,4

0,170

Холестерин**, ммоль/л

5,9±0,2

5,4±0,2

0,041

Триглицериды, ммоль/л

1,8±0,2

1,9±0,3

1,5±0,1

0,520

ЛПНП**, ммоль/л

3,4±0,2

2,8±0,2

0,017

ЛПВП, ммоль/л

1,1±0,0

1,2±0,1

1,1±0,1

0,370

СКФ (CKD-EPI), мл/мин/1,73 м2

59,8±3,4

67,1±2,7

62,7±2,3

0,220

 

Наблюдались статистически значимые различия в возрасте дебюта заболевания в зависимости от градаций генотипа по полиморфному участку rs7903146 гена TCF7L2. Так, у обладателей генотипа ТТ диабет манифестировал позже (в среднем в 59,5 лет), чем у пациентов с генотипами СТ и СС (56,1 лет, Р=0,044).

Концентрация базального С-пептида не отличалась у пациентов с генотипами ТТ (1,9 нг/мл), СТ (1,9 нг/мл), СС (2,5 нг/мл). При этом средние показатели базального С-пептида в группах пациентов с разными генотипами не выходили за рамки референсных значений (0,9–4,0 нг/мл). Вероятно, это обусловлено тем, что средняя длительность заболевания обследованной группы пациентов был небольшим (6,1 лет), и можно предположить, что функция бета-клеток у них еще сохранена.

Характеризуя состояние липидного обмена, интерес представляет тот факт, что, вне зависимости от генотипа, практически ни в одной из групп не достигнуты целевые значения показателей липидного обмена (ОХС, ЛПНП, ТГ). Лишь в группе пациентов с генотипом СТ значение уровня ТГ соответствует целевым показателям (согласно Алгоритмам специализированной медицинской помощи больным сахарным диабетом, 7-й выпуск).

При исследовании показателей липидного обмена во взаимосвязи с генетическим маркером TCF7L2 rs7903146 было выявлено, что уровни ОХС (5,4 ммоль/л) и ЛПНП (2,8 ммоль/л) были ниже у обладателей генотипа СТ при сопоставлении с генотипами СС+ТТ (5,9 ммоль/л, Р=0,041 и 3,4 ммоль/л, Р=0,017).

Для дальнейшего анализа были отобраны пациенты, которые не получали гиполипидемической терапии, данные представлены в таблице 5. Статистически значимых различий концентраций ОХС, ТГ, ЛПНП, ЛПВП в группах пациентов с генотипами СС, СТ, ТТ обнаружено не было. В доступной литературе данные об ассоциации маркера rs7903146 TCF7L2 с показателями липидного обмена также отсутствуют.

Таблица 5. Анализ параметров липидного обмена в зависимости от полиморфных вариантов гена TCF7L2 rs7903146 (ко-доминантная модель) у пациентов с СД2, не принимающих гиполипидемические препараты

Показатели липидного обмена

Генотипы

Р

СС

СТ

ТТ

Холестерин, ммоль/л

5,4±0,3

4,8±0,3

5,1±0,5

0,420

Триглицериды, ммоль/л

1,2±0,3

1,4±0,2

1,2±0,2

0,780

ЛПНП, ммоль/л

2,7±0,4

2,5±0,3

2,7±0,6

0,880

ЛПВП, ммоль/л

1,1±0,1

1,1±0,1

1,1±0,1

0,980

Примечание: * – рецессивная модель; ** – сверхдоминантная модель

 

Таким образом, полиморфный участок rs7903146 гена TCF7L2 ассоциирован с риском развития СД2 в популяции татар (жителей Республики Башкортостан), что согласуется с итогами исследований, проведенных в популяциях европеоидных народов как за рубежом, так и в Российской Федерации [4–11, 19–20]. При этом аллелем риска является аллель T (OR=1,61), а протективным – аллель C (OR=0,62).

В проведенном нами исследовании у пациентов с различными генотипами уровни базального С-пептида достоверно не отличались. Данные литературы о взаимосвязи полиморфного локуса rs7903146 TCF7L2 с базальной секрецией инсулина неоднозначны. Ряд работ демонстрирует более высокие уровни инсулина натощак у обладателей генотипа СС, в некоторых исследованиях зависимости базальной секреции инсулина от полиморфных вариант rs7903146 TCF7L2 не выявлено [19, 21]. Возможно, это связано с тем, что содержание инсулина крови зависит от многих факторов, в частности, имеет место «эффект первого прохождения», когда секретируемый инсулин поступает в печень, где частично метаболизируется, а лишь затем поступает в системный кровоток.

В нашем исследовании не обнаружено ассоциаций полиморфного участка rs7903146 гена TCF7L2 с ИМТ, в то время как в ряде работ такая ассоциация была продемонстрирована. Так, в популяции жителей Венгрии было показано, что носители аллеля Т имели более низкий ИМТ в сравнении с обладателями генотипа СС в группах пациентов с СД2 и LADA-диабетом [22].

Интересными представляются данные о возрасте манифестации СД2 в зависимости от генотипов rs7903146 TCF7L2. Так, у пациентов, имеющих в генотипе «защитный» аллель С, заболевание диагностировалось в среднем на 3,4 года раньше. По-видимому, в патогенезе СД2 у таких пациентов играют роль полиморфные варианты иных генов с более «агрессивным» влиянием на течение заболевания.

Заключение

Проведенное исследование позволило выявить ассоциацию полиморфного локуса rs7903146 гена TCF7L2 с СД2 у представителей татарской этнической группы Башкортостана. Показано, что генетическим маркером повышенного риска СД2 является аллель Т (OR=1,61).

Полученные результаты еще раз подчеркивают важность изучения молекулярно-генетических механизмов развития СД2 в зависимости от популяционной структуры населения. Для понимания патофизиологических основ СД2 необходимы дальнейшие репликативные исследования ассоциаций полиморфных маркеров, выявленных в процессе полногеномных поисков, с СД2 в различных популяциях Российской Федерации.

Информация о финансировании и конфликте интересов

Авторы декларируют отсутствие конфликта интересов, связанных с рукописью.

Работа получила частичную финансовую поддержку РГНФ №13-06-00101 и РФФИ 14-06-97003 р_Поволжье.

Участие авторов: Авзалетдинова Д.Ш. – подбор пациентов для исследования, подписание информированного согласия, сбор анамнеза, физикальное обследование, забор венозной крови, статистическая обработка данных, написание статьи; Шарипова Л.Ф. – подбор пациентов и лиц контрольной группы для исследования, подписание информированного согласия, сбор анамнеза, физикальное обследование, забор венозной крови, определение уровня липидов и С-пептида; Кочетова О.В. – проведение амплификации участков ДНК, написание статьи; Моругова Т.В. – подбор пациентов для исследования, забор венозной крови, написание статьи; Эрдман В.В. – выделение ДНК из венозной крови лиц контрольной группы; Сомова Р.Ш. – выделение ДНК из венозной крови пациентов с СД2; Мустафина О.Е. – контроль за проведением молекулярно-генетических исследований, написание статьи.

Diana S. Avzaletdinova

Bashkir State Medical University, Ufa

Author for correspondence.
Email: hyppocrat@mail.ru
ORCID iD: 0000-0002-1590-6433
SPIN-code: 5540-6951

Russian Federation

MD, Ph.D., Senior lecturer of Endocrinology department

Leisan F. Sharipova

Bashkir State Medical University, Ufa

Email: nauruzovaleisan@mail.ru

Russian Federation MD, Postgraduate student of Endocrinology department

Olga V. Kochetova

Institute of Biochemistry and Genetics of Ufa Scientific Centre of the Russian Academy of Sciences, Ufa

Email: olga_mk78@mail.ru
ORCID iD: 0000-0002-2944-4428
SPIN-code: 3461-3952

Russian Federation Ph.D. in Biology, Research associate

Tatyana Vyacheslavovna Morugova

Bashkir State Medical University, Ufa

Email: tmorugova@yandex.ru

Russian Federation MD, PhD, Professor, Chief of Endocrinology department

Vera V. Erdman

Institute of Biochemistry and Genetics of Ufa Scientific Centre of the Russian Academy of Sciences, Ufa

Email: fake@endojournals.com
SPIN-code: 2808-3955

Russian Federation PhD in Biology

Regina S. Somova

Institute of Biochemistry and Genetics of Ufa Scientific Centre of the Russian Academy of Sciences, Ufa

Email: remuscom@mail.ru

Russian Federation PhD in Biology, Reseach associate

Olga E. Mustafina

Institute of Biochemistry and Genetics of Ufa Scientific Centre of the Russian Academy of Sciences, Ufa

Email: anmareg@mail.ru
ORCID iD: 0000-0002-5118-6533
SPIN-code: 5757-8712

Russian Federation PhD in Biology, Chief of laboratory

  1. Medici F, Hawa M, Ianari A, et al. Concordance rate for type II diabetes mellitus in monozygotic twins: actuarial analysis. Diabetologia. 1999;42(2):146-150. doi: 10.1007/s001250051132
  2. Yi F, Sun J, Lim GE, et al. Cross talk between the insulin and Wnt signaling pathways: evidence from intestinal endocrine L cells. Endocrinology. 2008;149(5):2341-2351. doi: 10.1210/en.2007-1142
  3. Welters HJ, Kulkarni RN. Wnt signaling: relevance to beta-cell biology and diabetes. Trends Endocrinol Metab. 2008;19(10):349-355. doi: 10.1016/j.tem.2008.08.004
  4. Duggirala R, Blangero J, Almasy L, et al. Linkage of Type 2 Diabetes Mellitus and of Age at Onset to a Genetic Location on Chromosome 10q in Mexican Americans. Am J Hum Genet. 1999;64(4):1127-1140. doi: 10.1086/302316
  5. Reynisdottir I, Thorleifsson G, Benediktsson R, et al. Localization of a susceptibility gene for type 2 diabetes to chromosome 5q34-q35. 2. Am J Hum Genet. 2003;73(2):323-335. doi: 10.1086/377139
  6. Grant SF, Thorleifsson G, Reynisdottir I, et al. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet. 2006;38(3):320-323. doi: 10.1038/ng1732
  7. van Vliet-Ostaptchouk JV, Shiri-Sverdlov R, Zhernakova A, et al. Association of variants of transcription factor 7-like 2 (TCF7L2) with susceptibility to type 2 diabetes in the Dutch Breda cohort. Diabetologia. 2007;50(1):59-62. doi: 10.1007/s00125-006-0477-z.
  8. Horikoshi M, Hara K, Ito C, et al. A genetic variation of the transcription factor 7-like 2 gene is associated with risk of type 2 diabetes in the Japanese population. Diabetologia. 2007;50(4):747-751. doi: 10.1007/s00125-006-0588-6
  9. Mayans S, Lackovic K, Lindgren P, et al. TCF7L2 polymorphisms are associated with type 2 diabetes in northern Sweden. Eur J Hum Genet. 2007;15(3):342-346. doi: 10.1038/sj.ejhg.5201773
  10. Chauhan G, Spurgeon CJ, Tabassum R, et al. Impact of common variants of PPARG, KCNJ11, TCF7L2, SLC30A8, HHEX, CDKN2A, IGF2BP2, and CDKAL1 on the risk of type 2 diabetes in 5,164 Indians. Diabetes. 2010;59(8):2068-2074. doi: 10.2337/db09-1386
  11. Ng MC, Saxena R, Li J, et al. Transferability and fine mapping of type 2 diabetes loci in African Americans: the Candidate Gene Association Resource Plus Study. Diabetes. 2013;62(3):965-976. doi: 10.2337/db12-0266
  12. Perry JR, Frayling TM. New gene variants alter type 2 diabetes risk predominantly through reduced beta-cell function. Curr Opin Clin Nutr Metab Care. 2008;11(4):371-377. doi: 10.1097/MCO.0b013e32830349a1
  13. Yi F, Brubaker PL, Jin T. TCF-4 mediates cell type-specific regulation of proglucagon gene expression by beta-catenin and glycogen synthase kinase-3beta. J Biol Chem. 2005;280(2):1457-1464. doi: 10.1074/jbc.M411487200
  14. da Silva Xavier G, Loder MK, McDonald A, et al. TCF7L2 regulates late events in insulin secretion from pancreatic islet beta-cells. Diabetes. 2009;58(4):894-905. doi: 10.2337/db08-1187
  15. Hart LM, Simonis-Bik AM, Nijpels G, et al. Combined Risk Allele Score of Eight Type 2 Diabetes Genes Is Associated With Reduced First-Phase Glucose-Stimulated Insulin Secretion During Hyperglycemic Clamps. Diabetes. 2010;59(1):287-292. doi: 10.2337/db09-0736
  16. Lyssenko V, Lupi R, Marchetti P, et al. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest. 2007;117(8):2155-2163. doi: 10.1172/JCI30706
  17. Yi F, Brubaker PL, Jin T. TCF-4 mediates cell type-specific regulation of proglucagon gene expression by beta-catenin and glycogen synthase kinase-3beta. J Biol Chem. 2005;280(2):1457-1464. doi: 10.1074/jbc.M411487200
  18. Schafer SA, Tschritter O, Machicao F, et al. Impaired glucagon-like peptide-1-induced insulin secretion in carriers of transcription factor 7-like 2 (TCF7L2) gene polymorphisms. Diabetologia. 2007;50(12):2443-2450. doi: 10.1007/s00125-007-0753-6
  19. Бондарь И.А., Филипенко М.Л., Шабельникова О.Ю., Соколова Е.А. Ассоциация полиморфных маркеров rs7903146 гена TCF7L2 и rs1801282 гена PPARG (Pro12Ala) с сахарным диабетом 2 типа в Новосибирской области // Сахарный диабет. – 2013. – Т. 16. – №4. – C. 17-22. [Bondar’ IA, Filipenko ML, Shabel’nikova OY, Sokolova EA. Rs7903146 variant of TCF7L2 gene and rs18012824 variant of PPARG2 gene (Pro12Ala) are associated with type 2 diabetes mellitus in Novosibirsk population. Diabetes mellitus. 2013;16(4):17-22. (in Russ)] doi: 10.14341/DM2013417-22
  20. Никитин А.Г., Потапов В.А., Бровкин А.Н., и др. Ассоциация полиморфных маркеров гена TCF7L2 с сахарным диабетом 2 типа // Клиническая практика. – 2014. – №1. – С. 4-10. [Nikitin AG, Potapov VA, Brovkin AN, et al. association of the polymorphisms of the TCF7L2 genes with type 2 diabetes. 2014;(1):4-10. (in Russ)].
  21. Yan Y, North KE, Ballantyne CM, et al. Transcription factor 7-like 2 (TCF7L2) polymorphism and context-specific risk of type 2 diabetes in African American and Caucasian adults: the Atherosclerosis Risk in Communities study. Diabetes. 2009;58(1):285-289. doi: 10.2337/db08-0569
  22. Lukacs K, Hosszufalusi N, Dinya E, et al. The type 2 diabetes-associated variant in TCF7L2 is associated with latent autoimmune diabetes in adult Europeans and the gene effect is modified by obesity: a meta-analysis and an individual study. Diabetologia. 2012;55(3):689-693. doi: 10.1007/s00125-011-2378-z

Supplementary files

There are no supplementary files to display.

Views

Abstract - 1922

PDF (Russian) - 616

Cited-By


PlumX

Dimensions


Copyright (c) 2015 Avzaletdinova D.S., Sharipova L.F., Kochetova O.V., Morugova T.V., Erdman V.V., Somova R.S., Mustafina O.E.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies