Association of polymorphisms of the ADIPOQ, ADIPOR1 and ADIPOR2 genes with type 2 diabetes mellitus

Cover Page
  • Authors: Khodyrev D.S.1, Nikitin A.G.1, Brovkin A.N.1, Lavrikova E.Y.1, Lebedeva N.O.2, Vikulova O.K.2, Shamkhalova M.S.2, Shestakova M.V.2,3, Nosikov V.V.1, Averyanov A.V.1
  • Affiliations:
    1. Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow
    2. Endocrinology Research Centre, Moscow
    3. Sechenov First Moscow State Medical University, Moscow
  • Issue: Vol 18, No 2 (2015)
  • Pages: 5-11
  • Section: Genetics
  • URL: https://dia-endojournals.ru/dia/article/view/6848
  • DOI: https://doi.org/10.14341/DM201525-11
  • Cite item

Abstract


The study of hereditary predisposition to multifactorial diseases is essential for diagnosis and selection of the optimal treatment. The study of polymorphisms of candidate genes whose products are involved in the pathogenesis of multifactorial diseases is of great clinical importance.
Aim.
The aim of this study was to investigate the association of rs2241766 and rs1501299 polymorphisms in the ADIPOQ gene, rs2275737 and rs2275738 polymorphisms in the ADIPOR1 gene and rs11061971 and rs16928751 polymorphisms in the ADIPOR2 gene with the development of type 2 diabetes mellitus (T2DM) in the Russian population.
Materials and methods.
The study included a group of 500 patients with T2DM diagnosed based on standard diagnostic criteria (T2DM+). The control group (T2DM-) was a random sample of 500 patients with no evidence of the disease and was matched to the T2DM+ group for gender, age and body mass index. The determination of alleles and genotypes was performed using real-time polymerase chain reaction with TaqMan probes. The X2 test and contingency tables were used to compare the distribution of allele and genotype frequencies. A p-value of <0.05 was considered to be statistically significant.
Results.
Comparative analysis of the distribution of alleles and genotypes indicated an association between T2DM and the disease gene polymorphic marker rs11061971 ADIPOR2 (р = 0.004 for the distribution of alleles, р = 0.011 for the distribution of genotypes). The presence of allele A and genotype AA decreased the risk of development of T2DM (OR = 0.76 and 0.75, respectively), whereas the T allele carriers and TT genotype were associated with an increased risk of developing T2DM (OR = 1.31 and 1.63, respectively). There was no statistically significant association between T2DM and polymorphic markers of ADIPOQ or ADIPOR1 genes.
Conclusions.
Based on this data, polymorphism of the ADIPOR2 gene in the Russian population is associated with the development of T2DM, but there is no association between T2DM and polymorphism of the ADIPOQ or ADIPOR1 genes.

Full Text

Актуальность

Сахарный диабет (СД) – это группа обменных заболеваний, характеризующихся стойким повышением уровня глюкозы в крови вследствие нарушения секреции инсулина, действия инсулина или влияния обоих указанных факторов. По оценкам Всемирной Организации Здравоохранения (ВОЗ), количество больных СД неуклонно растет, особенно в промышленно развитых странах, и к 2030 г. СД станет седьмой по значимости причиной смерти, что представляет серьезную медико-социальную проблему во всем мире. Кроме того, последствиями СД являются нарушения функций разных органов (ВОЗ, 1999 г.). Самым распространенным типом диабета является СД 2 типа, на который приходится до 90% всех случаев заболевания диабетом в мире. Этот тип СД обычно развивается в зрелом возрасте и связан с ожирением, отсутствием физической активности и неправильным питанием. В настоящее время ключевыми звеньями патогенеза СД2 считают инсулинорезистентность (ИР), нарушение секреции инсулина, повышение продукции глюкозы печенью, а также наследственную предрасположенность и особенности образа жизни и питания, ведущие к ожирению. Свое­временная диагностика СД2 затрудняется тем, что в 50% случаев это заболевание не сопровождается никакими симптомами, и, как следствие, развиваются различные осложнения диабета, которые зачастую уже на этапе постановки диагноза носят необратимый характер.

В настоящее время наследственность как фактор риска, существенно увеличивающий возможность проявления болезни, не вызывает сомнения. В связи с этим изучение наследственной предрасположенности к СД2 крайне важно для его диагностики и терапии. Для оценки роли наследственных факторов в развитии СД2 большое значение для практики представляет исследование полиморфных маркеров в генах-кандидатах, продукты которых вовлечены в патогенез многофакторного заболевания. Кроме того, стоит учитывать характерную полигению, свойственную СД2, которая является результатом действия нескольких генетических локусов [1]. Различают две основные наследственные причины в формировании СД2 – это генетические дефекты β-клеточной функции и генетические дефекты действия инсулина. В свою очередь, генетический вклад можно разделить на два типа: гены, влияющие на развитие ИР в периферических тканях (мышцы, печень), и гены, связанные с нарушением развития, роста, пролиферации и функции β-клеток поджелудочной железы.

С целью поиска полезных генетических маркеров были выбраны гены адипонектин-опосредованного пути, которые, как известно, связаны с нарушением толерантности к глюкозе, ИР, ожирением и СД2. Генетические изменения в адипонектине (ADIPOQ) и рецепторе-1 и -2 адипонектина (ADIPOR1 и ADIPOR2) могут оказывать действие на развитие СД2.

Адипонектин играет важную роль в регуляции уровней глюкозы и окислении жирных кислот. Продукт гена ADIPOQ (расположен на хромосоме 3q27) – белок адипонектин, вырабатывается клетками белой жировой ткани и относится к семейству коллектинов. Он имеет гомологичное строение с коллагеном типа VIII и Х и комплементом С1q и участвует в регуляции различных метаболических процессов, включая обмен глюкозы и распад жиров [2]. Низкая концентрация адипонектина в крови ассоциирована со снижением окисления липидов, увеличением концентрации триглицеридов и нарушением потребления глюкозы клетками периферических тканей (такими, как печень, мышцы). Уменьшение уровня адипонектина в плазме отмечено у людей, страдающих ожирением и СД2, а также в линии мышей ob/ob (мыши с врожденным ожирением и гипергликемией) [3, 4]. Повышение концентрации эндогенного [5], а также введение экзогенного рекомбинантного адипонектина увеличивает чувствительность клеток к инсулину, а его пониженная концентрация, наоборот, ведет к развитию ИР и ожирения [5, 6]. Показано, что однонуклеотидная замена T45G (rs2241766) во втором экзоне гена ADIPOQ ассоциирована с ИР, нарушением глюкозотолерантности и высоким уровнем липопротеинов и холестерина в крови. Кроме того, этот полиморфный маркер был ассоциирован с повышенным риском развития инфаркта миокарда (ИМ) у арабов [7], а также показывал корреляцию с прогрессированием диабетической нефропатии у тайваньских мужчин с СД2 [8]. Другой полиморфный маркер G276T (rs1501299) гена ADIPOQ, исследованный в данной работе, связан с более высоким риском ИБС у китайских и бразильских пациентов [9, 10].

Рецептор типа 1 (AdipoR1, расположен на хромосоме 1q32) у человека синтезируется преимущественно в скелетной мускулатуре, тогда как рецептор типа 2 (AdipoR2, расположен на хромосоме 12р13.33) экспрессируется главным образом в печени. Аминокислотные последовательности рецепторов обнаруживают 67% гомологии.

При искусственном нарушении секреции инсулина, вызванном токсическим действием на β-клетки стрептозотоцина, и последующем развитии гипергликемии содержание мРНК AdipoR1 и AdipoR2 в скелетных мышцах и печени возрастает, а после введения инсулина снижается. Отмечена корреляция между экспрессией генов рецепторов адипонектина и чувствительностью к инсулину у человека [11]. Также показано, что экспрессия обоих генов снижена в скелетной мускулатуре у больных СД2 и в линии мышей с ИР и ожирением [12]. У мышей с инактивированными AdipoR1 и AdipoR2 наблюдали повышение уровня триглицеридов и развитие воспаления и окислительного стресса. Это приводило к состоянию ИР и невосприимчивости к повышению концентрации глюкозы [13]. В исследованиях на финской популяции найдена ассоциация трех маркеров гена ADIPOR1 (rs10920534, rs12045862 и rs7539542) с увеличением массы тела и снижением чувствительности к инсулину [14]. У европеоидов США достоверную связь с СД2 показали маркеры T(–102)G и A5843G гена ADIPOR1. При этом полиморфный маркер T(–102)G обнаружил неравновесное сцепление с полиморфным маркером Т(-106)С [15].

Некоторые варианты ADIPOR2 показали ассоциацию с ИР, снижением концентрации триглицеридов и уменьшением уровня окисления липидов [16, 17]. В финской популяции полиморфный маркер G795A (rs16928751) гена ADIPOR2 был связан с риском развития сердечно-сосудистых заболеваний у лиц с нарушенной толерантностью к глюкозе [18]. Однако следует отметить, что исследования ассоциации с СД2 в нескольких европейских популяциях показали противоречивые результаты [14, 19–21].

Цель

Целью настоящей работы было изучение ассоциации полиморфных маркеров rs2241766 и rs1501299 гена ADIPOQ, rs2275737 и rs2275738 гена ADIPOR1, rs11061971 и rs16928751 гена ADIPOR2с СД2 у русских больных, проживающих в г. Москве.

Материалы и методы

В исследование было включено 500 пациентов с установленным диагнозом СД2 («СД2+») (диагноз установлен на основании стандартных диагностических критериев) – группа Б. Контрольная группа («СД2-») представляла собой случайную выборку из 500 пациентов без признаков заболевания – группа К. Группы были сопоставимы по основным клиническим показателям: полу, возрасту и индексу массы тела (табл. 1).

Таблица 1. Клинико-лабораторная характеристика групп пациентов

Показатель

Б (N=500)

К (N=500)

Пол (м/ж)

268/232

256/244

Возраст, лет

60,7±6,3

61,2±10,4

Длительность диабета, лет

11,5±7,6

---

Индекс массы тела, кг/м2

28,9±5,5

27,2±4,8

Уровень глюкозы натощак1, ммоль/л

9,9±1,9

5,7±1,2

Уровень глюкозы плазмы через 2 ч после ПГТТ2, ммоль/л

12,5±1,8

6,7±0,9

Базальный уровень инсулина, мкЕд/мл

14,7±9,2

10,1±5,1

Уровень инсулина через 2 ч после ПГТТ, мкЕд/л

85,2±35,6

47,9±22,5

HOMA-β (инсулин натощак (мкЕд/л)×20/глюкоза натощак (ммоль/л)-3,5

46,5±24,1

82,2±45,2

HOMA-IR (глюкоза натощак (ммоль/л)1 инсулин натощак (мкЕд/мл)/22,5)

6,6±1,7

2,3±0,9

1Измерение уровня глюкозы проводилось в плазме венозной крови

2Пероральный глюкозотолерантный тест

Значения приведены как среднее +/- стандартное отклонение

 

У всех пациентов были измерены следующие параметры: концентрация глюкозы и инсулина в крови натощак, концентрация глюкозы и инсулина в крови через 2 ч после перорального глюкозотолерантного теста (ПГТТ), а также рассчитаны индексы HOMA-IR (Homeostasis model assessment-insulin resistance) и HOMA-β (homeostasis model assessment of β-cell function), необходимые соответственно для оценки функционирования β-клеток и оценки ИР тканей. Исследуемые группы формировались из числа пациентов ФГБУ «Эндокринологический научный центр». Все пациенты подписали информированное согласие на проведение исследования. Данное исследование было одобрено Этическим комитетом ФГБУ ЭНЦ. Выборки были этнически однородны и составлены из русских (по данным анкетирования).

Геномную ДНК выделяли из цельной крови больных посредством экстракции фенолом-хлороформом после инкубации образцов крови с протеиназой К в присутствии 0,1% додецилсульфата натрия.

Амплификацию полиморфных участков исследуе­мых генов проводили с помощью ПЦР «в реальном времени» на термоциклере ABI StepOnePlus (Applied Biosystems) в 20 мкл реакционной смеси следующего состава: 70 мМ Трис-HCl, pH 8,8, 16,6 мМ сульфат аммония, 0,01%-ный Твин-20, 2 мМ хлорид магния, 200 нМ каждого dNTP, 500 нМ праймеров, 250 нМ флуоресцентных зондов, 1,5 ед. Taq ДНК-полимеразы (термостабильная ДНК-полимераза Taq производства ЗАО «Евроген», г. Москва, олигонуклеотидные праймеры синтезированы ЗАО «Евроген», г. Москва, флуоресцентные зонды синтезированы ООО «ДНК-Синтез», г. Москва), 50–100 нг геномной ДНК. Условия амплификации фрагментов ДНК: 95°C/2 мин – 1-й цикл; 94°C/10 сек, 54–66°C/60 – 40 циклов, условия ПЦР, последовательности праймеров, флуоресцентных зондов приведены в табл. 2. Для всех исследованных локусов использовался метод детекции генотипов – TaqMan.

Таблица 2. Условия амплификации, последовательности праймеров и флуоресцентных зондов

Ген

Полиморфный маркер

Последовательность праймеров, 5`-3`

Последовательность зондов, 5`-3`

Температура отжига, °С

ADIPOQ

rs2241766

ggagctgttctactgcta

ctcctttctcacccttctc

ctctgcccgggcatgaccag

ctctgcccggtcatgaccag

65

rs1501299

caggtaagaatgtttctg

agaggaatcagaatatgaa

atataaactatatgaaggcattcattattaactaa

atataaactatatgaagtcattcattattaactaa

58

ADIPOR1

rs2275737

ctttgtgggaagacatct

gcttcttattcagtattagagtata

atggtagacactaaaagaaaatacaaacatgaagg

atggtagacactaaaagcaaatacaaacatgaagg

59

rs2275738

ctttgtgggaagacatct

gcttcttattcagtattagagtata

agacactaaaagaaaacacaaacatgaaggat

agacactaaaagaaaatacaaacatgaaggat

59

ADIPOR2

rs11061971

acgaagaggtgataatga

atagtagtagtagtagtagtagtag

aatgtggaggaagtggcagagg

aatgtggaggatgtggcagagg

58

rs16928751

tcttacctgctcttactc

ccttgcttcatctacttg

caaacatgtcccactgggagactata

caaacatgtcccattgggagactata

58

 

Используемые в зондах флуоресцентные красители – FAM (карбоксифлуоресцеин) и HEX (гексахлорофлуоресцеин), тушитель флуоресценции – BHQ-1.

Обозначения полиморфных маркеров даны в соответствии с базой данных dbSNP (http://www.ncbi.nlm.nih.gov/snp/).

Статистический анализ распределения частот генотипов проводили с использованием таблиц сопряженности и критерия хи-квадрат (χ2). Вычисления производили с помощью программы «Калькулятор для расчета статистики в исследованиях "случай-контроль"» (http://gen-exp.ru/calculator_or.php) и пакета статистических программ SPSS версии 17. Достоверными считали различия при p<0,05.

Результаты и обсуждение

Анализ ассоциации полиморфных маркеров rs2241766 и rs1501299 гена ADIPOQ.

Полиморфные маркеры rs2241766 и rs1501299 представляют собой замены T/G в экзоне 2 и G/Т в интроне 2 соответственно. Множественные данные указывают на связь изменения уровня адипонектина с нарушением многих метаболических характеристик, а также с уменьшением чувствительности клеток к инсулину. Так как состояние невосприимчивости к действию инсулина участвует в патогенезе СД2, то были предприняты попытки поиска ассоциации различных полиморфных маркеров с ИР [3–6].

При анализе распределения частот и аллелей и генотипов полиморфных маркеров rs2241766 и rs1501299 гена ADIPOQ в группах «СД2+» – Б и «СД2-» – К значимых статистических различий обнаружено не было (табл. 3, 4). Для полиморфного маркера rs2241766 данные согласуются с работой, выполненной на меньшей (129 против 500 в настоящей работе) выборке пациентов русской популяции [22].

Таблица 3. Сравнительный анализ распределения частот аллелей и генотипов полиморфного маркера rs2241766 гена ADIPOQ в группах Б и К

Аллели и генотипы

Частота аллелей и генотипов, N/%

Значение c2

Уровень значимости p

OR*

Б

К

N=500

N=500

значение

CI 95%

Аллель T

921/0,921

917/0,917

0,11

0,7431

1,06

0,77–1,46

Аллель G

79/0,079

83/0,083

0,95

0,69–1,31

Генотип T/T

435/0,870

431/0,862

0,17

0,9188

1,07

0,74–1,54

Генотип T/G

51/0,102

55/0,110

0,92

0,61–1,38

Генотип G/G

14/0,028

14/0,028

1,00

0,47–2,12

*OR – odds ratio (http://gen-exp.ru/calculator_or.php)

 

Таблица 4. Сравнительный анализ распределения частот аллелей и генотипов полиморфного маркера rs1501299 гена ADIPOQ в группах Б и К

Аллели и генотипы

Частота аллелей и генотипов, N/%

Значение c2

Уровень значимости p

OR

Б

К

N=500

N=500

значение

CI 95%

Аллель C

693/0,693

681/0,681

0,33

0,5629

1,06

0,88–1,28

Аллель A

307/0,307

319/0,319

0,95

0,78–1,14

Генотип C/C

261/0,522

258/0,516

0,68

0,7106

1,02

0,80–1,31

Генотип C/A

171/0,342

165/0,330

1,06

0,81–1,37

Генотип A/A

68/0,136

77/0,154

0,86

0,61–1,23

 

Анализ ассоциации полиморфных маркеров rs22753738 и rs2275737 гена ADIPOR1

Ген рецептора 1-го типа к адипонектину экспрессируется в основном в скелетной мускулатуре. Нарушение работы рецепторов этого типа было ассоциировано с развитием ожирения и ИР, а также повышением уровня триглицеридов [11–13]. Все это может способствовать развитию СД2.

При анализе распределения частот и аллелей и генотипов полиморфных маркеров rs22753738 и rs2275737 гена ADIPOR1 в группах «СД2+» и «СД2-» значимых статистических различий обнаружено не было (табл. 5, 6). Для полиморфного маркера rs22753738 данные согласуются с работой, выполненной на меньшей (129 против 500 в настоящей работе) выборке пациентов русской популяции [22].

Таблица 5. Сравнительный анализ распределения частот аллелей и генотипов полиморфного маркера rs2275738 гена ADIPOR1 в группах Б и К

Аллели и генотипы

Частота аллелей и генотипов, N/%

Значение c2

Уровень значимости p

OR

Б

К

N=500

N=500

значение

CI 95%

Аллель T

520/0,520

484/0,484

2,59

0,1075

1,15

0,97–1,38

Аллель C

480/0,480

516/0,516

0,87

0,73–1,03

Генотип T/T

162/0,324

134/0,268

3,84

0,1467

1,31

1,00–1,72

Генотип T/C

196/0,392

216/0,432

0,85

0,66–1,09

Генотип C/C

142/0,284

150/0,300

0,93

0,70–1,22

 

Таблица 6. Сравнительный анализ распределения частот аллелей и генотипов полиморфного маркера rs2275737 гена ADIPOR1 в группах Б и К

Аллели и генотипы

Частота аллелей и генотипов, N/%

Значение c2

Уровень значимости p

OR

Б

К

N=500

N=500

значение

CI 95%

Аллель C

586/0,586

569/0,569

0,59

0,4416

1,07

0,90–1,28

Аллель A

414/0,414

431/0,431

0,93

0,78–1,11

Генотип C/C

189/0,378

179/0,358

0,52

0,7698

1,09

0,84–1,41

Генотип C/A

208/0,416

211/0,422

0,98

0,76–1,25

Генотип A/A

103/0,206

110/0,220

0,92

0,68–1,25

 

Анализ ассоциации полиморфных маркеров rs11061971 и rs16928751 гена ADIPOR2

Ген рецептора 2-го типа, в отличие от 1-го, экспрессируется в основном клетками печени. Это может иметь дополнительное значение в развитии глюкозотолерантности, так как печень является основным депо глюкозы в организме.

При анализе распределения частот и аллелей и генотипов полиморфных маркеров rs11061971 и rs16928751 гена ADIPOR2 в группах «СД2+» – Б и «СД2-» – К, для полиморфного маркераrs11061971 была обнаружена статистически значимая ассоциация с СД2 в русской популяции (табл. 7).

 

Таблица 7. Сравнительный анализ распределения частот аллелей и генотипов полиморфного маркера rs11061971 гена ADIPOR2 в группах Б и К

Аллели и генотипы

Частота аллелей и генотипов, N/%

Значение c2

Уровень значимости p

OR

Б

К

N=500

N=500

значение

CI 95%

Аллель A

601/0,601

664/0,664

8,54

0,004

0,76

0,64–0,91

Аллель T

399/0,399

336/0,336

1,31

1,09–1,57

Генотип A/A

185/0,370

219/0,438

8,97

0,011

0,75

0,58–0,97

Генотип A/T

231/0,462

226/0,452

1,04

0,81–1,34

Генотип T/T

84/0,168

55/0,110

1,63

1,13–2,35

 

Так, наличие аллеля А и генотипа АА снижало риск развития СД2 (OR=0,76 и 0,75 соответственно), в то же время у носителей аллеля Т и генотипа ТТ риск развития СД2 был увеличен (OR=1,31 и 1,63 соответственно). Данные согласуются с работой, выполненной на меньшей (129 против 500 в настоящей работе) выборке пациентов русской популяции [22]. В то же время, для полиморфного маркера rs16928751 в группах «СД2+» – Б и «СД2-» – К значимых статистических различий обнаружено не было (табл. 8).

 

Таблица 8. Сравнительный анализ распределения частот аллелей и генотипов полиморфного маркера rs16928751 гена ADIPOR2 в группах Б и К

Аллели и генотипы

Частота аллелей и генотипов, N/%

Значение c2

Уровень значимости p

OR

Б

К

N=500

N=500

значение

CI 95%

Аллель G

826/0,826

856/0,856

3,37

0,0667

0,80

0,63–1,02

Аллель A

174/0,174

144/0,144

1,25

0,98–1,59

Генотип G/G

341/0,682

369/0,738

3,83

0,1476

0,76

0,58–1,00

Генотип G/A

144/0,288

118/0,236

1,31

0,99–1,74

Генотип A/A

15/0,030

13/0,026

1,16

0,55–2,46

Заключение

На основании полученных нами данных можно сделать вывод о том, что в русской популяции гены, определяющие пониженную чувствительность периферических тканей к действию инсулина (ADIPOQ, ADIPOR1 и ADIPOR2), в гораздо меньшей степени ассоциированы с развитием СД2, чем в зарубежных исследованиях. В то же время следует отметить, что один из полиморфных маркеров гена ADIPOR2 показал ассоциацию с развитием СД2 в русской популяции, хотя в полных геномных поисках ассоциация этого гена с СД2 не была обнаружена.

Все эти данные говорят о важности исследования предрасполагающих генетических факторов, вклад которых в развитие заболевания существенно изменяется в зависимости от популяции. Выявление генетических маркеров риска СД2 позволяет лучше понять основной патологический механизм развития этого заболевания и в соответствии с этим выбрать оптимальную терапию заболевания, а также использовать полученные данные для профилактики СД2 у здоровых людей.

Информация о финансировании и конфликте интересов

Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Финансирование исследования осуществлялось за счет Государственного задания ФМБА России.

About the authors

Dmitry Sergeevich Khodyrev

Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow

Email: avialn@gmail.com

Russian Federation

PhD in BiologySenior research associate, Laboratory of Genetics

Aleksey Georgievna Nikitin

Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow

Email: avialn@gmail.com

Russian Federation

PhD in Biology, Head of Laboratory of Genetics

Aleksey Nikolaevich Brovkin

Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow

Email: avialn@gmail.com

Russian Federation

PhD in Biology, Senior research associate, Laboratory of Genetics

Elena Yur'evna Lavrikova

Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow

Email: avialn@gmail.com

Russian Federation

PhD in Biology, Senior research associate, Laboratory of Genetics

Nadezhda Olegovna Lebedeva

Endocrinology Research Centre, Moscow

Author for correspondence.
Email: nadegda.lebedeva@yandex.ru

Russian Federation

MD, Research fellow

Olga Konstantinovna Vikulova

Endocrinology Research Centre, Moscow

Email: olga-vikulova-1973@yandex.ru

Russian Federation

MD, PhD, Leading research associate, Department of Diabetic Nephropathy and Haemodialysis

Minara Shamkhalovna Shamkhalova

Endocrinology Research Centre, Moscow

Email: shamkhalova@mail.ru

Russian Federation

MD, PhD, Head of Department of Diabetic Nephropathy and Haemodialysis

Marina Vladimirovna Shestakova

Endocrinology Research Centre, Moscow; Sechenov First Moscow State Medical University, Moscow

Email: nephro@endocrincentr.ru

Russian Federation

MD, PhD, professor, corresponding member of Russian Academy of Sciences, director of Diabetes Institute of the Endocrinology Research Centre, head of the Diabetology and endocrinology department of the Pediatric faculty in Sechenov First Moscow State Medical University

Valery Vyacheslavovich Nosikov

Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow

Email: nosikov@genetika.ru

Russian Federation MD, PhD in Biology, Professor, Head of Laboratory for Molecular Diagnostics and genetic fingerprinting (Russian State Scientific Centre “RosNII Genetika”), leading research assistant in Laboratory of Genetics (Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies)

Alexander Vyacheslavovich Averyanov

Federal Research Clinical Centre for Specialized Types of Health Care and Medical Technologies, Moscow

Email: averyanovav@mail.ru

Russian Federation

MD, PhD, Deputy Director for Science and Medical Technology

References

  1. Пузырев В.П., Степанов В.А. Патологическая анатомия генома человека. // Новосибирск.: Наука. Сибирское предприятие РАН; 1997. [Puzyrev VP, Stepanov VA. Patologicheskaya anatomiya genoma cheloveka. Novosibirsk: Nauka. Sibirskoe predpriyatie RAN; 1997.]
  2. Diez J, Iglesias P. The role of the novel adipocyte-derived hormone adiponectin in human disease. European Journal of Endocrinology. 2003;148(3):293-300. doi: 10.1530/eje.0.1480293
  3. Hotta K, Funahashi T, Arita Y, et al. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arteriosclerosis, thrombosis, and vascular biology. 2000;20(6):1595-1599. doi: 10.1161/01.atv.20.6.1595
  4. Statnick MA, Beavers LS, Conner LJ, et al. Decreased expression of apm1 in omental and subcutaneous adipose tissue of humans with type 2 diabetes. International journal of experimental diabetes research. 2000;1(2):81-88. doi: 10.1155/EDR.2000.81
  5. Spranger J, Ristow M, Otto B, et al. Post-prandial decrease of human plasma ghrelin in the absence of insulin. Journal of endocrinological investigation. 2003;26(8):RC19-RC22. doi: 10.1007/BF03347349
  6. Gu HF, Abulaiti A, Östenson C-G, et al. Single nucleotide polymorphisms in the proximal promoter region of the adiponectin (APM1) gene are associated with type 2 diabetes in swedish caucasians. Diabetes. 2004;53(suppl 1):S31-S35. doi: 10.2337/diabetes.53.2007.S31
  7. Shaker O, Ismail M. Association of genetic variants of mthfr, enpp1, and adipoq with myocardial infarction in egyptian patients. Cell Biochem Biophys. 2014;69(2):265-274. doi: 10.1007/s12013-013-9794-2
  8. Chung H-F, Long KZ, Hsu C-C, et al. Adiponectin gene (ADIPOQ) polymorphisms correlate with the progression of nephropathy in Taiwanese male patients with type 2 diabetes. Diabetes research and clinical practice. 2014;105(2):261-270. doi: 10.1016/j.diabres.2014.04.015
  9. Gui M-H, Li X, Jiang S-F, et al. Association of the adiponectin gene rs1501299 G>T variant, serum adiponectin levels, and the risk of coronary artery disease in a Chinese population. Diabetes research and clinical practice. 2012;97(3):499-504. doi: 10.1016/j.diabres.2012.05.011
  10. Oliveira CSV, Saddi-Rosa P, Crispim F, et al. Association of ADIPOQ variants, total and high molecular weight adiponectin levels with coronary artery disease in diabetic and non-diabetic Brazilian subjects. Journal of diabetes and its complications. 2012;26(2):94-98. doi: 10.1016/j.jdiacomp.2012.02.008
  11. Civitarese AE, Jenkinson CP, Richardson D, et al. Adiponectin receptors gene expression and insulin sensitivity in non-diabetic Mexican Americans with or without a family history of Type 2 diabetes. Diabetologia. 2004;47(5):816-820. doi: 10.1007/s00125-004-1359-x
  12. Inukai K, Nakashima Y, Watanabe M, et al. Regulation of adiponectin receptor gene expression in diabetic mice. American Journal of Physiology - Endocrinology and Metabolism. 2005;288(5):E876-E882
  13. Yamauchi T, Nio Y, Maki T, et al. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat Med. 2007;13(3):332-339. doi: 10.1038/nm1557
  14. Damcott CM, Ott SH, Pollin TI, et al. Genetic variation in adiponectin receptor 1 and adiponectin receptor 2 is associated with type 2 diabetes in the old order amish. Diabetes. 2005;54(7):2245-2250. doi: 10.2337/diabetes.54.7.2245
  15. Siitonen N, Pulkkinen L, Mager U, et al. Association of sequence variations in the gene encoding adiponectin receptor 1 (ADIPOR1) with body size and insulin levels. The Finnish Diabetes Prevention Study. Diabetologia. 2006;49(8):1795-1805. doi: 10.1007/s00125-006-0291-7
  16. Richardson DK, Schneider J, Fourcaudot MJ, et al. Association between variants in the genes for adiponectin and its receptors with insulin resistance syndrome (IRS)-related phenotypes in Mexican Americans. Diabetologia. 2006;49(10):2317-2328. doi: 10.1007/s00125-006-0384-3
  17. Siitonen N, Pulkkinen L, Lindström J, et al. Association of ADIPOR2 gene variants with cardiovascular disease and type 2 diabetes risk in individuals with impaired glucose tolerance: the Finnish Diabetes Prevention Study. Cardiovascular diabetology. 2011;10:83-83. doi: 10.1186/1475-2840-10-83
  18. Loos RJ, Ruchat S, Rankinen T, et al. Adiponectin and adiponectin receptor gene variants in relation to resting metabolic rate, respiratory quotient, and adiposity-related phenotypes in the Québec Family Study. The American journal of clinical nutrition. 2007;85(1):26-34.
  19. Vaxillaire M, Dechaume A, Vasseur-Delannoy V, et al. Genetic analysis of ADIPOR1 and ADIPOR2 candidate polymorphisms for type 2 diabetes in the caucasian population. Diabetes. 2006;55(3):856-861. doi: 10.2337/diabetes.55.03.06.db05-0665
  20. Peters KE, Beilby J, Cadby G, et al. A comprehensive investigation of variants in genes encoding adiponectin (ADIPOQ) and its receptors (ADIPOR1/R2), and their association with serum adiponectin, type 2 diabetes, insulin resistance and the metabolic syndrome. BMC Medical Genetics. 2013;14:15-15. doi: 10.1186/1471-2350-14-15
  21. Mather KJ, Christophi CA, Jablonski KA, et al. Common variants in genes encoding adiponectin (ADIPOQ) and its receptors (ADIPOR1/2), adiponectin concentrations, and diabetes incidence in the Diabetes Prevention Program. Diabetic medicine: a journal of the British Diabetic Association. 2012;29(12):1579-1588. doi: 10.1111/j.1464-5491.2012.03662.x
  22. Potapov VA, Chistiakov DA, Dubinina A, et al. Adiponectin and adiponectin receptor gene variants in relation to type 2 diabetes and insulin resistance-related phenotypes. The review of diabetic studies: RDS. 2008;5(1):28-37. doi: 10.1900/RDS.2008.5.28

Supplementary files

There are no supplementary files to display.

Statistics

Views

Abstract - 2503

PDF (Russian) - 1068

Cited-By


PlumX

Dimensions


Copyright (c) 2015 Khodyrev D.S., Nikitin A.G., Brovkin A.N., Lavrikova E.Y., Lebedeva N.O., Vikulova O.K., Shamkhalova M.S., Shestakova M.V., Nosikov V.V., Averyanov A.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies